The M protein of SARS CoV is localized in the endoplasmic reticulum (ER), Golgi, and ER Golgi intermediate compartment (ERGIC) [31,32]
The M protein of SARS CoV is localized in the endoplasmic reticulum (ER), Golgi, and ER Golgi intermediate compartment (ERGIC) [31,32]. immunodominant epitope in the TGEV membrane protein endodomain was identified. The results of this study have implications for further research on TGEV replication. Keywords: immunodominant epitope, coronavirus, membrane protein, endodomain 1. Introduction Coronaviruses (CoVs) are clustered in the subfamily and 3-Indoleacetic acid are divided into four genera (alpha-, beta-, gamma-, and deltacoronavirus) [1,2]. CoVs are enveloped, single-stranded, positive-sense RNA viruses [3,4,5]. The CoV genomes range from 26.2 kb to 31.7 kb in size. Four structural proteins are encoded by the CoV genomes: spike (S), membrane (M), envelope (E), and nucleocapsid (N). Transmissible gastroenteritis virus (TGEV) is an excellent model of CoV biology [6,7,8,9,10,11,12]. The M protein is the viral assembly scaffold and the most abundant protein in the viral envelope [13]. The avian infectious bronchitis virus (IBV) M protein contains Golgi-targeting information in its first transmembrane domain [14], whereas the transmembrane domains and the cytoplasmic tail domain 3-Indoleacetic acid of the mouse hepatitis virus (MHV) M protein play important roles in Golgi targeting [15,16]. The M protein interacts with the E, S, and N proteins and plays an essential role in virus assembly [17,18,19]. M is a necessary component of virus-like particles (VLP) during viral assembly [18,20,21,22]. The M proteins interact other M proteins to form homo-oligomers [23]. In MHV, the M protein interacts with S, and deletion of the cytoplasmic tail of the M protein abolishes the effective interaction between the two proteins [24,25]. Interactions between the M and S proteins have also been identified in IBV [26], bovine coronavirus [27], and severe acute respiratory 3-Indoleacetic acid syndrome (SARS)-CoV [17,21]. The CoV M protein plays an important role in virion morphogenesis [28]. The M protein is composed of the following CAPN1 three regions: a small extracellular domain (ectodomain), a transmembrane domain (Tm), and a large carboxyl terminal domain (endodomain) [29]. The signal peptide of the M protein is located at amino acids (aa) 1C16 [30]. A single tyrosine in the M protein cytoplasmic tail is important for efficient interaction with the S protein of SARS-CoV [13]. The M protein of SARS CoV is localized in the endoplasmic reticulum (ER), Golgi, and ER Golgi intermediate compartment (ERGIC) [31,32]. The cytoplasmic tail of the CoV M protein is essential for its retention in the Golgi [16]. Current diagnostic tools for TGEV detection usually rely on PCR, and a specific method of indirect immunofluorescence assay (IFA) for TGEV detection is needed. TGEV M protein epitopes have been reported previously [28,33], but few functional studies have examined the cytoplasmic terminal domain (endodomain) of the CoV M protein. Monoclonal antibodies (mAbs) to the M protein are needed to dissect the function of the CoV M protein cytoplasmic tail. In this study, the 1C3 and 4C7 mAbs against the TGEV M protein cytoplasmic tail are described. Two linear epitopes, 243YSTEART249 (1C3) and 243YSTEARTDNLSEQEKLLHMV262 (4C7), were identified in the M protein endodomain. An immunodominant epitope (aa 243C262) in the TGEV membrane protein endodomain was identified. The results of this study have implications for further research on TGEV replication. 2. Materials and Methods 2.1. Cells, Antibodies, and Virus Porcine kidney 15 (PK-15) cells and Vero E6 cells were grown in DMEM medium supplemented with 10% fetal calf serum (5% CO2 and 37 C). TGEV infectious strain H (Accession No. FJ755618) was propagated on PK-15 cells. Porcine epidemic diarrhea virus (PEDV) strain CV777 (Accession No. AF353511), the mAb against N protein of PEDV, and the mAb against N protein of TGEV were maintained in our lab. PEDV strain CV777 was propagated on Vero E6 cells. 2.2. Recombinant Plasmid Construction and Recombinant Protein Expression The pCold-TGEV-M plasmid was constructed using the F-GST-M and R-GST-M primers (Table 1). Seven partial TGEV M genes corresponding to M protein amino acids (aa) 17C76 (nt 49C228), aa 67C126 (nt 199C378), aa 117C176 (nt 349C528), aa 167C226 (nt 499C678), aa 217C262 (nt 649C789), aa 217C246 (nt 649C738), and aa 234C262 (nt 700C789) were amplified with the primers shown in Table 1, which contained the HI and I restriction enzyme sites. The PCR products were cloned into the prokaryotic expression plasmid pGEX-6p-1. The recombinant plasmids were named pGEX GST-M1 (aa 17C76), pGEX GST-M2 (aa 67C126), pGEX GST-M3 (aa 117C176), pGEX GST-M4 (aa 167C226), pGEX GST-M5 (aa 217C262), pGEX GST-M6 (aa 217C246), and pGEX GST-M7 (aa 234C262). Table 1 Primers used in this study. IR-GST-MCGGAATTCTTATACCATATGTARI F-M (49C228)-6pGTGGATCCGAACGCTATTGTGCTATGAAHIR-M (49C228)-6pGACTCGAGGAATTGAGGTCTTCCATATTIF-M (199C378)-6pGTGGATCC ACTGTGCTACAATATGGAAGHIR-M (199C378)-6pGACTCGAGAAATGTAACAATTGCACCTGIF-M (349C528)-6pGTGGATCCTTTAGTATTGCAGGTGCAATHIR-M (349C528)-6pGACTCGAGACCAGTTGGCACACCTTCGAIF-M (499C678)-6pGTGGATCCGTGCTTCCTCTCGAAGGTGTHIR-M (499C678)-6pGACTCGAGTGCTTTCAACTTCTTGCCAAIF-M (649C789)-6pGTGGATCCTACACACTTGTTGGCAAGAAHIR-M (649C789)-6pGACTCGAGTTATACCATATGTAATAATTIF-M (649C738)-6pGTGGATCCTACACACTTGTTGGCAAGAAHIR-M (649C738)-6pGACTCGAGCTCTGTTGAGTAATCACCAGIF-M (700C789)-6pGTGGATCCTACTATGTAAAATCTAAAGCHIR-M (700C789)-6pGACTCGAGTTATACCATATGTAATAATTI Open in a separate window 2.3. Preparation of mAbs Targeting the M Protein Proteins were expressed in BL21 (DE3) using previously described methods [34]. The GST-M fusion protein was purified using.